ID Labs · Infectious Disease Diagnostics & Genomic Intelligence

Advanced Infectious Disease Diagnostics

From rapid pathogen detection to antimicrobial resistance and genomic characterisation.

Detection → Identification → Resistance → Characterisation → Clinical Decision Support — through Culture, Serology, PCR, Multiplex PCR, AST, Mycobacteriology, NGS and WGS.

Maximum TAT of 24 hours from collection for all major tests (ID Labs stated specification).

Syndromic MultiplexMolecular DiagnosticsMycobacteriologyMicrobiologySerologyAMRNGSWGS
Diagnostic Portfolio

A structured diagnostic catalogue

View complete portfolio
East India's only dedicated ID lab

Every infection
leaves a signature.
We read it.

Molecular diagnostics, mycobacteriology, culture & AST, serology and Nanopore genomics — from sample to answer in as little as 24 hours, out of our BSL-3 facility in Kolkata.

NANOPORE — LIVE BASECALLINGSEQUENCING
TACATAAGGTGGTTTCTGTTATGTGAAATAGATGAATAGCCTCCAATT
Featured Diagnostics

Flagship tests & technologies

Scientific Evidence

Grounded in published science

Publications library

WHO Consolidated Guidelines on Tuberculosis: Module 3 — Diagnosis: Rapid Diagnostics for Tuberculosis Detection

WHO Guidelines · 2021 (updated)

WHO recommendations on rapid molecular diagnostics for TB, including Xpert MTB/RIF and line probe assays, and their place within diagnostic algorithms. These are international guidelines; they do not constitute ID Labs validated performance data.

Rapid Molecular Detection of Tuberculosis and Rifampin Resistance

New England Journal of Medicine · 2010

Multicentre evaluation of the Xpert MTB/RIF assay demonstrating rapid, sensitive detection of tuberculosis and rifampicin resistance directly from sputum, compared with smear microscopy and culture.

Duration of hypotension before initiation of effective antimicrobial therapy is the critical determinant of survival in human septic shock

Critical Care Medicine · 2006

Landmark study showing that each hour of delay in effective antimicrobial therapy after the onset of septic shock is associated with a measurable decrease in survival — the evidence base for rapid diagnostics in sepsis.

Scientific governance

Every performance claim on this platform is labelled by source: ID Labs Specification, ID Labs Validated Performance, Manufacturer Specification or Published Scientific Evidence. Where data is unavailable it is marked "Data to be updated" — never invented.

About ID Labs

A specialised infectious-disease laboratory

IDLABS DIAGNOSTIC PRIVATE LIMITED is a specialised infectious-disease testing laboratory with a comprehensive advanced facility, including a BSL-3 containment area, working with Next Generation Sequencing, Whole Genome Sequencing, Molecular Diagnostics and Syndromic Panels on platforms such as Oxford Nanopore and Real-Time PCR.

Our dedicated molecular laboratory at Kolkata (Barrackpore) serves West Bengal with a maximum turnaround of 24 hours from collection for all major tests.

Learn more about ID Labs

Need a test or technical information?

Clinicians and healthcare organisations can request product documentation, panel configurations and turnaround details directly from our scientific team.